Paste
Copy
Cut
Options

¡Tu solución está lista!

Nuestra ayuda de expertos desglosó tu problema en una solución confiable y fácil de entender.

Mira la respuesta

  • Pregunta: Below is a sequence of a bacterial gene: The template strand is in red. a. Assuming that transcription begins at the first T on the template strand, and continues to the end, what would be the mRNA sequence

    Below is a sequence of a bacterial gene:

    student submitted image, transcription available below

    The template strand is in red.

    a. Assuming that transcription begins at the first T on the template strand, and continues to the end, what would be the mRNA sequence that is derived from this fragment?

    b.Find the start codon of this mRNA.

    c. Will there be any effect on the translation by changing the first G in the template strand to a C? If any effect occurs, what would it be?

    d. Will there be any effect on the translation by changing the last T in the template strand to a C? If any effect occurs, what would it be?

    Muestra el texto de la transcripción de la imagen
  • Chegg Logo
    Esta es la mejor manera de resolver el problema.
    Solución
    100% (1 calificación)

    Go through t…

    Mira la respuesta completa
    answer image blur
Texto de la transcripción de la imagen:
4. A continuación, se presenta una secuencia de un gen bacteriano: 5' GTATCGTATGCATGCATCGTGAC 3 ' 3' CATAGCATACGTACGTAGCACTG 3' La hebra molde esta en rojo. a. Asumiendo que la transcripción comienza en el primer T en la hebra molde, y continúa al final, ¿cuál sería la secuencia de mRA que se deriva de este fragmento? b. Halle el codón de iniciación en este mRNA. c. ¿Habrá algún efecto en la traducción al cambiar la primera G en la hebra molde por una C? Si ocurre algún efecto, ¿cuál sería? d. ¿Habrá algún efecto en la traducción al cambiar el último T en la hebra molde por una C? Si ocurre algún efecto, ¿cuál sería?