Biology Archive: Questions from April 21, 2022
-
Para la siguiente pregunta determine si es transición, transversion, inserción o eliminación. Favor indicar el cambio ocurrido Secuencia Normal 5'TTCCGGAAGTATCATT3' Mutante 5'TTCCGGAAGTATCATTT30 answers -
Para la siguiente pregunta determine si es transición, transversión, inserción o eliminación. Favor indicar el cambio ocurrido Secuencia Normal 5'TTCCGGAAGTATCATT3 Mutante 4 5'TTCCGGAAGAATCATT33 answers -
Determine y seriale el tipo de mutación en las siguientes secuencias de mRNA y de aminoácidos (con sentido, sin sentido, silenciosa, cambio marco de lectu ra) Secuencia normal 5 CCGGAUGUUCCGGAAGUCAU0 answers -
Determine y señale el tipo de mutación en las siguientes secuencias de mRNA y de aminoácidos (con sentido, sin sentido, silenciosa, cambio marco de lectu ra) Secuencia normal 5 CCGGAUGUUCCGGAAGUCAU0 answers -
En genes represibles, la unión del activador con un inhibidor activa el proceso de transcripción. True False0 answers -
in repressible genes, binding of the activator with an inhibitor activates the transcription process
En genes represibles, la unión del activador con un inhibidor activa el proceso de transcripción. True False1 answer -
in inducible genes, activators require the inducing molecule for transcription to occur
En genes inducibles, los activadores necesitan de la molécula inductora para que ocurre la transcripción True False1 answer -
repressible genes are not expressed in the presence of a corepressor
Los genes represibles no se expresan en presencia de un corepresor. True False1 answer -
1 answer
-
Si la siguiente es una parte de un mRNA para sintetizar una proteina AUG-CCG ACG-GM Cual debe de ser la secuencia del Molde de ADN que le dio orien 0 5 UAC GGC UGC-CUU 5 TAC-GGC-TGC-CIT 0.3 UAC-GGC-UG1 answer